8697 - 13307 Mus Musculus - Deletions Deletion length: 4609 bp	Breakpoint flanking sequences more information in Documentation - Flanking regions
	8697 5fl vs 3fl Homology length: 1 bp Deleted region 13307 CCTCCTTCTAACATCAGGTC ├ 5'Breakpoint ┤ TAGTAATATGATTTCACTAT (...) GCAAATCCATATTCATCCTT ├ 3'Breakpoint ┤ CTCAACTTTACTGGGGTTTT 5del vs 3del Homology length: 1 bp CCTCCTTCTAACATCAGGTC ├ 5'Breakpoint ┤ TAGTAATATGATTTCACTAT (...) GCAAATCCATATTCATCCTT ├ 3'Breakpoint ┤ CTCAACTTTACTGGGGTTTT

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [5] Wang, E., et al., The rate of mitochondrial mutagenesis is faster in mice than humans.Mutation Research. 1997. 377(2): p. 157-66.