8623 - 15663 Homo sapiens - Deletions Deletion length: 7039 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	8623 Deleted region 15663 TCCCCCTCTATTGATCCCCA ├ 5'Breakpoint ┤ CCTCCAAATATCTCATCAAC (...) CATCCTAGCAATAATCCCCA ├ 3'Breakpoint ┤ TCCTCCATATATCCAAACAA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
Stem cells
Myopathic symptoms; Skeletal muscle biopsies and fibroblasts of CMT2A patients; Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [29] Kleinle, S., et al., Detection and characterization of mitochondrial DNA rearrangements in Pearson and Kearns-Sayre syndromes by long PCR. Human Genetics. 1997. 100(5-6): p. 643-50.

 [303] Van Haute, L., et al., Human embryonic stem cells commonly display large mitochondrial DNA deletions. Nature Biotechnology. 2013. 31(1): p. 20-23.

 [329] Vielhaber, Stefan, et al., Mitofusin 2 mutations affect mitochondrial function by mitochondrial DNA depletion. Acta Neuropathologica. 2013. 125(2): p. 245-256.

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.