8576 - 12984 Homo sapiens - Deletions Deletion length: 4407 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	8576 5fl vs 3del Homology length: 8 bp Deleted region 12984 GCCCCCACAATCCTAGGCCT ├ 5'Breakpoint ┤ ACCCGCCGCAGTACTGATCA (...) CTCACCCCACTACTAGGCCT ├ 3'Breakpoint ┤ CCTCCTAGCAGCAGCAGGCA 5fl vs 3fl Homology length: 3 bp GCCCCCACAATCCTAGGCCT ├ 5'Breakpoint ┤ ACCCGCCGCAGTACTGATCA (...) CTCACCCCACTACTAGGCCT ├ 3'Breakpoint ┤ CCTCCTAGCAGCAGCAGGCA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
Aged tissues
Ptosis

References

 [2] Goios, A., et al., mtDNA single macrodeletions associated with myopathies: absence of haplogroup-related increased risk. Journal of Inherited Metabolic Disease. 2005. 28(5): p. 769-78.

 [14] Eshaghian, A., et al., Mitochondrial DNA deletions serve as biomarkers of aging in the skin, but are typically absent in nonmelanoma skin cancers. Journal of Investigative Dermatology. 2006. 126(2): p. 336-44.