Loading, please wait...

Loading, please wait.



8536 - 15642
Homo sapiens - Deletions

Deletion length: 7105 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
8536 Deleted region 15642
GAGAACCAAAATGAACGAAA 5'Breakpoint ATCTGTTCGCTTCATTCATT (...) TGCCCTATTACTATCCATCC 3'Breakpoint TCATCCTAGCAATAATCCCC




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [3] Bai, R.K. and L.J.C. Wong, Simultaneous detection and quantification of mitochondrial DNA deletion(s) depletion and over-replication in patients with mitochondrial disease. Journal of Molecular Diagnostics. 2005. 7(5): p. 613-622.