Loading, please wait...

Loading, please wait.



8484 - 13460
Homo sapiens - Deletions

Deletion length: 4975 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
8484 Deleted region 13460
CACCTACCTCCCTCACCAAA 5'Breakpoint GCCCATAAAAATAAAAAATT (...) CACTTCAACCTCCCTCACCA 3'Breakpoint TTGGCAGCCTAGCATTAGCA




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
PS
Aged tissues
Mesial temporal lobe epilepsy

References

 [324] Wei, Y. H., Mitochondrial DNA alterations as ageing-associated molecular events. Mutation Research. 1992. 275(2-3): p. 145-55.

 [349] Siri, B., et al. , Adrenocortical function in patients with Single Large Scale Mitochondrial DNA Deletions: a retrospective single centre cohort study.European Journal of Endocrinology. 2023. 189(5): p.485-494.

 [350] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy.Acta neuropathologica. 2016. 32: p.277-288.