Loading, please wait...

Loading, please wait.



8484 - 13448
Homo sapiens - Deletions

Deletion length: 4963 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
8484 Deleted region 13448
CACCTACCTCCCTCACCAAA 5'Breakpoint GCCCATAAAAATAAAAAATT (...) AACCATACCTCTCACTTCAA 3'Breakpoint CCTCCCTCACCATTGGCAGC




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
Mitochondrial myopathy
Aged tissues
Parkinson Disease

References

 [114] Bender, A., et al., High levels of mitochondrial DNA deletions in substantia nigra neurons in aging and Parkinson disease. Nature Genetics. 2006. 38(5): p. 515-517.

 [356] Frascarelli, C., et al., Nanopore long-read next-generation sequencing for detection of mitochondrial DNA large-scale deletions..Frontiers in Genetics . 2023. 1: p.1089956.