8482 - 13460 Homo sapiens - Duplications Duplication length: 11592 bp Duplicated region: 13460:8482 Partially duplicated molecule length: 28161 bp Duplicates OL and OH Duplicating part of minor and major arcs	Breakpoint flanking sequences more information in Documentation - Flanking regions
	8482 5fl vs 3del Homology length: 13 bp Non-duplicated region 13460 ACCACCTACCTCCCTCACCA ├ 5'Breakpoint ┤ AAGCCCATAAAAATAAAAAA (...) CACTTCAACCTCCCTCACCA ├ 3'Breakpoint ┤ TTGGCAGCCTAGCATTAGCA 5del vs 3del Homology length: 1 bp ACCACCTACCTCCCTCACCA ├ 5'Breakpoint ┤ AAGCCCATAAAAATAAAAAA (...) CACTTCAACCTCCCTCACCA ├ 3'Breakpoint ┤ TTGGCAGCCTAGCATTAGCA

Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [5] Fromenty, B., et al., High proportions of mtDNA duplications in patients with Kearns-Sayre syndrome occur in the heart. American Journal of Medical Genetics. 1997. 71: p. 443-452

 [24] Poulton, J., et al., Families of mtDNA re-arrangements can be detected in patients with mtDNA deletions: duplications may be a transient intermediate form. Human Molecular Genetics. 1993. 2(1): p. 23-30.

 [25] Ferlin, T., et al., Detection of mitochondrial DNA deletions by a screening procedure using the polymerase chain reaction. Molecular and Cellular Biochemistry. 1997. 174: p. 221-225.

 [27] Odoardi, F., et al., Pathogenic role of mtDNA duplications in mitochondrial diseases associated with mtDNA deletions. American Journal of Medical Genetics. 2003. 118A: p. 247-254.