Loading, please wait...

Loading, please wait.



8477 - 13590
Homo sapiens - Deletions

Deletion length: 5112 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
8477 Deleted region 13590
AAACTACCACCTACCTCCCT 5'Breakpoint CACCAAAGCCCATAAAAATA (...) ACTCTCATCGCTACCTCCCT 3'Breakpoint GACAAGCGCCTATAGCACTC




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
Aged tissues
Multisystemic mitochondrial disorders; Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [8] Brierley, E.J., et al., Role of mitochondrial DNA mutations in human aging: implications for the central nervous system and muscle. Annals of Neurology. 1998. 43(2): p. 217-23.

 [322] Sadikovic, B., et al., Sequence homology at the breakpoint and clinical phenotype of mitochondrial DNA deletion syndromes. Plos one. 2010. 5(12): p. e15687.

 [326] Hjelm, B.E., et al., . in preparation

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.