8475 - 14381 Homo sapiens - Deletions Deletion length: 5905 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	8475 5fl vs 3del Homology length: 9 bp Deleted region 14381 ACAAACTACCACCTACCTCC ├ 5'Breakpoint ┤ CTCACCAAAGCCCATAAAAA (...) ACAGCACCAATCCTACCTCC ├ 3'Breakpoint ┤ ATCGCTAACCCCACTAAAAC 5del vs 3del Homology length: 1 bp ACAAACTACCACCTACCTCC ├ 5'Breakpoint ┤ CTCACCAAAGCCCATAAAAA (...) ACAGCACCAATCCTACCTCC ├ 3'Breakpoint ┤ ATCGCTAACCCCACTAAAAC

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
KSS
Aged tissues
Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [9] Bua, E., et al., Mitochondrial DNA-deletion mutations accumulate intracellularly to detrimental levels in aged human skeletal muscle fibers. American Journal of Human Genetics. 2006. 79(3): p. 469-80.

 [322] Sadikovic, B., et al., Sequence homology at the breakpoint and clinical phenotype of mitochondrial DNA deletion syndromes. Plos one. 2010. 5(12): p. e15687.

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.