8470 - 13446 Homo sapiens - Deletions Deletion length: 4975 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	8470 5fl vs 3fl Homology length: 1 bp Deleted region 13446 TAAACACAAACTACCACCTA ├ 5'Breakpoint ┤ CCTCCCTCACCAAAGCCCAT (...) AAAACCATACCTCTCACTTC ├ 3'Breakpoint ┤ AACCTCCCTCACCATTGGCA 5del vs 3del Homology length: 1 bp TAAACACAAACTACCACCTA ├ 5'Breakpoint ┤ CCTCCCTCACCAAAGCCCAT (...) AAAACCATACCTCTCACTTC ├ 3'Breakpoint ┤ AACCTCCCTCACCATTGGCA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [339] Zhu, Q., Chen, C., & Yao, J., Kearns–Sayre syndrome with a novel large-scale deletion: a case report..BMC ophthalmology. 2022. 22(1): p.35.

 [344] Anteneová, N., et al., The phenotypic spectrum of 47 Czech patients with single, large-scale mitochondrial DNA deletions..Brain sciences. 2020. 10(11): p. 766.

 [345] Loos, M.A., et al., Clinical and molecular characterization of mitochondrial DNA disorders in a group of Argentinian pediatric patients..Molecular Genetics and Metabolism Reports. 2021. 27: p.100733.