Loading, please wait...

Loading, please wait.



8468 - 13446
Homo sapiens - Deletions

Deletion length: 4977 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
8468 Deleted region 13446
ATTAAACACAAACTACCACC 5'Breakpoint TACCTCCCTCACCAAAGCCC (...) AAAACCATACCTCTCACTTC 3'Breakpoint AACCTCCCTCACCATTGGCA




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
KSS; PEO
Inclusion body myositis

References

 [11] Degoul, F., et al., Different Mechanisms Inferred from Sequences of Human Mitochondrial-DNA Deletions in Ocular Myopathies. Nucleic Acids Research. 1991. 19(3): p. 493-496.

 [24] Moslemi, A.R., C. Lindberg, and A. Oldfors, Analysis of multiple mitochondrial DNA deletions in inclusion body myositis. Human Mutation. 1997. 10(5): p. 381-6.

 [44] Tengan, C.H., et al., Frequency of duplications in the D-loop in patients with mitochondrial DNA deletions. Biochimica Et Biophysica Acta. 2002. 1588(1): p. 65-70.