8439 - 16075 Homo sapiens - Deletions Deletion length: 7635 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	8439 5fl vs 3del Homology length: 7 bp Deleted region 16075 ACACTATTCCTCATCACCCA ├ 5'Breakpoint ┤ ACTAAAAATATTAAACACAA (...) CCCAAGTATTGACTCACCCA ├ 3'Breakpoint ┤ TCAACAACCGCTATGTATTT 5del vs 3del Homology length: 1 bp ACACTATTCCTCATCACCCA ├ 5'Breakpoint ┤ ACTAAAAATATTAAACACAA (...) CCCAAGTATTGACTCACCCA ├ 3'Breakpoint ┤ TCAACAACCGCTATGTATTT

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [25] Samuels, D.C., E.A. Schon, and P.F. Chinnery, Two direct repeats cause most human mtDNA deletions. Trends in Genetics. 2004. 20(9): p. 393-8.

 [163] Zhang, C., et al., Multiple Mitochondrial-DNA Deletions in an Elderly Human Individual. FEBS Letters. 1992. 297(1-2): p. 34-38.