Loading, please wait...

Loading, please wait.



8424 - 11503
Homo sapiens - Duplications

Duplication length: 13491 bp
Duplicated region: 11503:8424

Partially duplicated molecule length: 30060 bp

Duplicates OL and OH
Duplicating part of minor and major arcs



Breakpoint flanking sequences
more information in Documentation - Flanking regions
8424 Non-duplicated region 11503
ACCCCCATACTCCTTACACT 5'Breakpoint ATTCCTCATCACCCAACTAA (...) GGTATAATACGCCTCACACT 3'Breakpoint CATTCTCAACCCCCTGACAA




Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [17] Wong, L-J. C., et al., Compensatory amplification of mtDNA in a patient with a novel deletion/duplication and high mutant load. Journal of Medical Genetics. 2003. 10: p. e125.