Loading, please wait...

Loading, please wait.



8412 - 15664
Homo sapiens - Deletions

Deletion length: 7251 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
8412 Deleted region 15664
CCCACCATAATTACCCCCAT 5'Breakpoint ACTCCTTACACTATTCCTCA (...) ATCCTAGCAATAATCCCCAT 3'Breakpoint CCTCCATATATCCAAACAAC




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
PEO
Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [142] Hirt, L., et al., Large deletion (7.2 kb) of mitochondrial DNA with novel boundaries in a case of progressive external ophthalmoplegia. Journal of Neurology, Neurosurgery and Psychiatry. 1996. 61(4): p. 422-3.

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.