Loading, please wait...

Loading, please wait.



8305 - 14619
Homo sapiens - Deletions

Deletion length: 6313 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
8305 Deleted region 14619
TCTAGAGCCCACTGTAAAGC 5'Breakpoint TAACTTAGCATTAACCTTTT (...) AGGAGAAGGCTTAGAAGAAA 3'Breakpoint ACCCCACAAACCCCATTACT




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [38] Lim, P.S., et al., Mitochondrial DNA mutations and oxidative damage in skeletal muscle of patients with chronic uremia. Journal of Biomedical Science. 2002. 9(6 Pt 1): p. 549-60.