8133 - 12965 Rattus norvegicus - Deletions Deletion length: 4832 bp	Breakpoint flanking sequences more information in Documentation - Flanking regions
	8133 5fl vs 3del Homology length: 15 bp Deleted region 12965 CGAACCTGAGCCCTAATAAT ├ 5'Breakpoint ┤ TGTATCCCTAATTATATTTA (...) AACGCCTGAGCCCTAATAAT ├ 3'Breakpoint ┤ CACTTTAATCGCCACATCCA 5del vs 3del Homology length: 1 bp CGAACCTGAGCCCTAATAAT ├ 5'Breakpoint ┤ TGTATCCCTAATTATATTTA (...) AACGCCTGAGCCCTAATAAT ├ 3'Breakpoint ┤ CACTTTAATCGCCACATCCA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [ 1] Tanhauser, S. M., Laipis, P. J., Multiple deletions are detectable in mitochondrial DNA of aging mice.The Journal of Biological Chemistry. 1995. 20(42): p. 24769-75.

 [8] Kong, W. J., et al., The relation between D-galactose injection and mitochondrial DNA 4834 bp deletion mutation.Experimental Gerontology. 2006. 41(6): p. 628-34.

 [10 ] Zhong, Y., et al., Contribution of common deletion to total deletion burden in mitochondrial DNA from inner ear of D-galactose-induced aging rats.Mutation Research. 2011. 712(1-2): p. 11-9.