Loading, please wait...

Loading, please wait.



7967 - 11312
Homo sapiens - Deletions

Deletion length: 3344 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
7967 Deleted region 11312
CATACTTCCCCCATTATTCC 5'Breakpoint TAGAACCAGGCGACCTGCGA (...) TACTCACTCTCACTGCCCAA 3'Breakpoint GAACTATCAAACTCCTGAGC




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
sideroblastic anemia/mitochondrial myopathy
Mild pancreatic insufficiency and progressive muscle weakness. autosomal dominant inheritance

References

 [277] Casademont, J., et al., Multiple deletions of mtDNA in two brothers with sideroblastic anemia and mitochondrial myopathy and in their asymptomatic mother. Human Molecular Genetics. 1994. 3(11): p. 1945-9.