Loading, please wait...

Loading, please wait.



7841 - 13905
Homo sapiens - Deletions

Deletion length: 6063 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
7841 Deleted region 13905
ATCCCTACGCATCCTTTACA 5'Breakpoint TAACAGACGAGGTCAACGAT (...) CTATGCACATTTTATTTCTC 3'Breakpoint CAACATACTCGGATTCTACC




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [120] Hsieh, R.H., et al., Age-dependent respiratory function decline and DNA deletions in human muscle mitochondria. Biochemistry and Molecular Biology International. 1994. 32(6): p. 1009-22.

 [121] Yen, T.C., et al., Age-dependent increase of mitochondrial DNA deletions together with lipid peroxides and superoxide dismutase in human liver mitochondria. Free Radical Biology and Medicine. 1994. 16(2): p. 207-14.

 [122] Yen, T.C., et al., Age-dependent 6kb deletion in human liver mitochondrial DNA. Biochemistry International. 1992. 26(3): p. 457-68.

 [210] Anan, R., et al., Cardiac involvement in mitochondrial diseases. A study on 17 patients with documented mitochondrial DNA defects. Circulation. 1995. 91(4): p. 955-61.