7823 - 13653 Mus Musculus - Deletions Deletion length: 5829 bp	Breakpoint flanking sequences more information in Documentation - Flanking regions
	7823 5fl vs 3del Homology length: 5 bp Deleted region 13653 TATCTCATCAATAATTACCC ├ 5'Breakpoint ┤ TATTTATCTTATTTCAACTA (...) ACTATATATTGCCGCTACCC ├ 3'Breakpoint ┤ CAATCCCTCCTTCCAACATA 5fl vs 3fl Homology length: 1 bp TATCTCATCAATAATTACCC ├ 5'Breakpoint ┤ TATTTATCTTATTTCAACTA (...) ACTATATATTGCCGCTACCC ├ 3'Breakpoint ┤ CAATCCCTCCTTCCAACATA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [7] Inoue, K., et al., Isolation of mitochondrial DNA-less mouse cell lines and their application for trapping mouse synaptosomal mitochondrial DNA with deletion mutations.The Journal of Biological Chemistry. 1997. 272(24): p. 15510-5.

 [10] Ikushima, T., et al., Induction of a large deletion in mitochondrial genome of mouse cells by X-ray irradiation.International Congress Series. 2002. 1236: p. 331-334.