Loading, please wait...

Loading, please wait.



7814 - 14805
Homo sapiens - Deletions

Deletion length: 6990 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
7814 Deleted region 14805
CATCATCCTAGTCCTCATCG 5'Breakpoint CCCTCCCATCCCTACGCATC (...) AATTAACCACTCATTCATCG 3'Breakpoint ACCTCCCCACCCCATCCAAC




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
KSS
Aged tissues
Diffuse leukodystrophy; Major Depressive Disorder; Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [33] Reeve, A.K., et al., Nature of mitochondrial DNA deletions in substantia nigra neurons. American Journal of Human Genetics. 2008. 82(1): p. 228-35.

 [275] Nakai, A., et al., Diffuse leukodystrophy with a large-scale mitochondrial DNA deletion. Lancet. 1994. 343(8910): p. 1397-8.

 [326] Hjelm, B.E., et al., . in preparation

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.

 [349] Siri, B., et al. , Adrenocortical function in patients with Single Large Scale Mitochondrial DNA Deletions: a retrospective single centre cohort study.European Journal of Endocrinology. 2023. 189(5): p.485-494.