Loading, please wait...

Loading, please wait.



7489 - 1442
Homo sapiens - Deletions

Deletion length: 10521 bp

Removes OH
Inside the minor arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
7489 Deleted region 1442
CCAAAGCTGGTTTCAAGCCA 5'Breakpoint ACCCCATGGCCTCCATGACT (...) GATTTAGCAGTAAACTAAGA 3'Breakpoint GTAGAGTGCTTAGTTGAACA




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
Chronic PEO
Skeletal muscle biopsies

References

 [345] Loos, M.A., et al., Clinical and molecular characterization of mitochondrial DNA disorders in a group of Argentinian pediatric patients..Molecular Genetics and Metabolism Reports. 2021. 27: p.100733.