7454 - 15316 Macaca mulatta - Deletions Deletion length: 7861 bp	Breakpoint flanking sequences more information in Documentation - Flanking regions
	7454 5fl vs 3del Homology length: 2 bp Deleted region 15316 ATCTTATAGCCCCTATAACT ├ 5'Breakpoint ┤ TTTTCGGCAAGGTATTAGAA (...) CCCTTCATCATCATCGCCCT ├ 3'Breakpoint ┤ CACAACCGTGCACCTACTAT 5del vs 3del Homology length: 1 bp ATCTTATAGCCCCTATAACT ├ 5'Breakpoint ┤ TTTTCGGCAAGGTATTAGAA (...) CCCTTCATCATCATCGCCCT ├ 3'Breakpoint ┤ CACAACCGTGCACCTACTAT

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [3] Lee, C. M., et al., Direct repeat sequences are not required at the breakpoints fo age-associated mitochondrial deletions in rhesus monkeys.Mechanisms of Ageing and Development. 1994. 75(1): p. 69-79.