Loading, please wait...

Loading, please wait.



7360 - 14920
Homo sapiens - Duplications

Duplication length: 9010 bp
Duplicated region: 14920:7360

Partially duplicated molecule length: 25579 bp

Duplicates OL and OH
Duplicating part of minor and major arcs



Breakpoint flanking sequences
more information in Documentation - Flanking regions
7360 Non-duplicated region 14920
CGAAAAGTCCTAATAGTAGA 5'Breakpoint AGAACCCTCCATAAACCTGG (...) GCCATGCACTACTCACCAGA 3'Breakpoint CGCCTCAACCGCCTTTTCAT




Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [9] Poltoun, J., et al., Tandem direct duplications of mitochondrial DNA in mitochondrial myopathy: analysis of nucleotide sequence and tissue distribution. Nucleic Acids Research. 1989. 17(24): p. 10223-10229.