7357 - 15916 Homo sapiens - Duplications Duplication length: 8011 bp Duplicated region: 15916:7357 Partially duplicated molecule length: 24580 bp Duplicates OL and OH Duplicating part of minor and major arcs	Breakpoint flanking sequences more information in Documentation - Flanking regions
	7357 5fl vs 3fl Homology length: 1 bp Non-duplicated region 15916 AAGCGAAAAGTCCTAATAGT ├ 5'Breakpoint ┤ AGAAGAACCCTCCATAAACC (...) AGTATAAACTAATACACCAG ├ 3'Breakpoint ┤ TCTTGTAAACCGGAGATGAA 5del vs 3del Homology length: 2 bp AAGCGAAAAGTCCTAATAGT ├ 5'Breakpoint ┤ AGAAGAACCCTCCATAAACC (...) AGTATAAACTAATACACCAG ├ 3'Breakpoint ┤ TCTTGTAAACCGGAGATGAA

Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
KSS
Diabetes mellitus

References

 [24] Poulton, J., et al., Families of mtDNA re-arrangements can be detected in patients with mtDNA deletions: duplications may be a transient intermediate form. Human Molecular Genetics. 1993. 2(1): p. 23-30.