Loading, please wait...

Loading, please wait.



7354 - 15913
Homo sapiens - Duplications

Duplication length: 8011 bp
Duplicated region: 15913:7354

Partially duplicated molecule length: 24580 bp

Duplicates OL and OH
Duplicating part of minor and major arcs



Breakpoint flanking sequences
more information in Documentation - Flanking regions
7354 Non-duplicated region 15913
TCGAAGCGAAAAGTCCTAAT 5'Breakpoint AGTAGAAGAACCCTCCATAA (...) TGTAGTATAAACTAATACAC 3'Breakpoint CAGTCTTGTAAACCGGAGAT




Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [14] Poulton, J., et al., Duplications of mitochondrial DNA: Implications in pathogenesis. Journal of Inherited Metabolism Disorders. 1992. 15: p. 487-498.