Loading, please wait...

Loading, please wait.



7122 - 14000
Homo sapiens - Deletions

Deletion length: 6877 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
7122 Deleted region 14000
CTCAGGCTACACCCTAGACC 5'Breakpoint AAACCTACGCCAAAATCCAT (...) GCCCCTACTCCTCCTAGACC 3'Breakpoint TAACCTGACTAGAAAAGCTA




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
Multiple deletion patient (POLG1mut)
Aged tissues
Parkinson Disease
PEO, Parkinson

References

 [32] Kraytsberg, Y., et al., Mitochondrial DNA deletions are abundant and cause functional impairment in aged human substantia nigra neurons. Nature Genetics. 2006. 38(5): p. 518-20.

 [33] Reeve, A.K., et al., Nature of mitochondrial DNA deletions in substantia nigra neurons. American Journal of Human Genetics. 2008. 82(1): p. 228-35.