Loading, please wait...

Loading, please wait.



6961 - 16071
Homo sapiens - Deletions

Deletion length: 9109 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
6961 Deleted region 16071
CTTTTCACCGTAGGTGGCCT 5'Breakpoint GACTGGCATTGTATTAGCAA (...) ACCACCCAAGTATTGACTCA 3'Breakpoint CCCATCAACAACCGCTATGT




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
Mitochondrial myopathy
Proximal limb weakness; Chronic fatigue syndrome; other neurological symptoms

References

 [15] Regan, C., Sequence characterization of breakpoint regions of human mitochondrial DNA deletions and possible mechanisms of formation. PhD Thesis. 1999.