Loading, please wait...

Loading, please wait.



6537 - 13838
Homo sapiens - Deletions

Deletion length: 7300 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
6537 Deleted region 13838
CATCACTATACTACTAACAG 5'Breakpoint ACCGCAACCTCAACACCACC (...) TTTCCTAGGACTTCTAACAG 3'Breakpoint CCCTAGACCTCAACTACCTA




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
Aged tissues
Parkinson Disease
Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [32] Kraytsberg, Y., et al., Mitochondrial DNA deletions are abundant and cause functional impairment in aged human substantia nigra neurons. Nature Genetics. 2006. 38(5): p. 518-20.

 [33] Reeve, A.K., et al., Nature of mitochondrial DNA deletions in substantia nigra neurons. American Journal of Human Genetics. 2008. 82(1): p. 228-35.

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.