6476 - 14146 Homo sapiens - Deletions Deletion length: 7669 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	6476 Deleted region 14146 TCTGATCCGTCCTAATCACA ├ 5'Breakpoint ┤ GCAGTCCTACTTCTCCTATC (...) TAACCCTACTCCTAATCACA ├ 3'Breakpoint ┤ TAACCTATTCCCCCGAGCAA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
Aged tissues
Wolfram syndrome; Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [33] Reeve, A.K., et al., Nature of mitochondrial DNA deletions in substantia nigra neurons. American Journal of Human Genetics. 2008. 82(1): p. 228-35.

 [265] Rocher, C., et al., Base composition at mtDNA boundaries suggests a DNA triple helix model for human mitochondrial DNA large-scale rearrangements. Molecular Genetics and Metabolism. 2002. 76(2): p. 123-32.

 [294] Rotig, A., et al., Deletion of Mitochondrial-DNA in a Case of Early-Onset Diabetes-Mellitus, Optic Atrophy, and Deafness (Wolfram Syndrome, Mim 222300). Journal of Clinical Investigation. 1993. 91(3): p. 1095-1098.

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.