Loading, please wait...

Loading, please wait.



6405 - 13660
Homo sapiens - Deletions

Deletion length: 7254 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions


6405
5fl vs 3fl
Homology length: 2 bp

Deleted region


13660
CATCAATTTCATCACAACAA 5'Breakpoint TTATCAATATAAAACCCCCT (...) CTCGCTTCCCCACCCTTACT 3'Breakpoint AACATTAACGAAAATAACCC
5del vs 3del
Homology length: 1 bp

CATCAATTTCATCACAACAA 5'Breakpoint TTATCAATATAAAACCCCCT (...) CTCGCTTCCCCACCCTTACT 3'Breakpoint AACATTAACGAAAATAACCC




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [331] Neuhaus, J.F., et al., Catecholamine Metabolism Induces Mitochondrial DNA Deletions and Leads to Severe Adrenal Degeneration during Aging. Neuroendocrinology. 2017. 104(1): p. 72-84.