6341 - 14005 Homo sapiens - Deletions Deletion length: 7663 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	6341 Deleted region 14005 GAGCCTCCGTAGACCTAACC ├ 5'Breakpoint ┤ ATCTTCTCCTTACACCTAGC (...) TACTCCTCCTAGACCTAACC ├ 3'Breakpoint ┤ TGACTAGAAAAGCTATTACC

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
KSS; Mitochondrial myopathy
MNGIE; ad-PEO; Patients with pathogenic POLG mutations
Ptosis; Proximal limb weakness; Encephalopathy; Tubulopathy; Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [15] Regan, C., Sequence characterization of breakpoint regions of human mitochondrial DNA deletions and possible mechanisms of formation. PhD Thesis. 1999.

 [40] Mita, S., et al., Recombination Via Flanking Direct Repeats Is a Major Cause of Large-Scale Deletions of Human Mitochondrial-DNA. Nucleic Acids Research. 1990. 18(3): p. 561-567.

 [265] Rocher, C., et al., Base composition at mtDNA boundaries suggests a DNA triple helix model for human mitochondrial DNA large-scale rearrangements. Molecular Genetics and Metabolism. 2002. 76(2): p. 123-32.

 [282] Johns, D.R., et al., Multiple mitochondrial DNA deletions in myo-neuro-gastrointestinal encephalopathy syndrome. American Journal of Ophthalmology. 1993. 115(1): p. 108-9.

 [315] Chae, J-H., et al., A single large-scale deletion of mtDNA ina child with recurrent encephalopathy nad tubulopaphy. Journal of Neurological Sciences. 2010. 292: p. 104-106.

 [326] Hjelm, B.E., et al., . in preparation

 [327] Nicholls, Thomas J., et al., Linear mtDNA fragments and unusual mtDNA rearrangements associated with pathological deficiency of MGME1 exonuclease. Human Molecular Genetics. 2014. 23: p. 6147-6162.

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.

 [339] Zhu, Q., Chen, C., & Yao, J., Kearns–Sayre syndrome with a novel large-scale deletion: a case report..BMC ophthalmology. 2022. 22(1): p.35.

 [356] Frascarelli, C., et al., Nanopore long-read next-generation sequencing for detection of mitochondrial DNA large-scale deletions..Frontiers in Genetics . 2023. 1: p.1089956.