6186 - 15806 Macaca mulatta - Deletions Deletion length: 9619 bp	Breakpoint flanking sequences more information in Documentation - Flanking regions
	6186 5fl vs 3fl Homology length: 1 bp Deleted region 15806 CCCTTCTTTCCTGCTACTAA ├ 5'Breakpoint ┤ TAGCATCCGCCGTGGTAGAA (...) CTATCGGCCAAGTAGCATCC ├ 3'Breakpoint ┤ ATAATATACTTCATCACAAT 5del vs 3del Homology length: 8 bp CCCTTCTTTCCTGCTACTAA ├ 5'Breakpoint ┤ TAGCATCCGCCGTGGTAGAA (...) CTATCGGCCAAGTAGCATCC ├ 3'Breakpoint ┤ ATAATATACTTCATCACAAT

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [1] Gokey, N. G., et al., Molecular analyses of mtDNA deletion mutations in microdissected skeletal muscle fibers from aged rhesus monkeys.Aging cell. 2004. 3(5): p. 319-26.