Loading, please wait...

Loading, please wait.



6173 - 16078
Homo sapiens - Deletions

Deletion length: 9904 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
6173 Deleted region 16078
CCCTAATAATCGGTGCCCCC 5'Breakpoint GATATGGCGTTTCCCCGCAT (...) AAGTATTGACTCACCCATCA 3'Breakpoint ACAACCGCTATGTATTTCGT




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
Aged tissues
Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [17] Fayet, G., et al., Ageing muscle: clonal expansions of mitochondrial DNA point mutations and deletions cause focal impairment of mitochondrial function. Neuromuscular Disorders. 2002. 12(5): p. 484-93.

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.