Loading, please wait...

Loading, please wait.



6131 - 15056
Homo sapiens - Duplications

Duplication length: 7645 bp
Duplicated region: 15056:6131

Partially duplicated molecule length: 24214 bp

Duplicates OL and OH
Duplicating part of minor and major arcs



Breakpoint flanking sequences
more information in Documentation - Flanking regions
6131 Non-duplicated region 15056
TAATACCCATCATAATCGGA 5'Breakpoint GGCTTTGGCAACTGACTAGT (...) ACATCGGGCGAGGCCTATAT 3'Breakpoint TACGGATCATTTCTCTACTC




Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [9] Poltoun, J., et al., Tandem direct duplications of mitochondrial DNA in mitochondrial myopathy: analysis of nucleotide sequence and tissue distribution. Nucleic Acids Research. 1989. 17(24): p. 10223-10229.