Loading, please wait...

Loading, please wait.



6021 - 14848
Homo sapiens - Duplications

Duplication length: 7743 bp
Duplicated region: 14848:6021

Partially duplicated molecule length: 24312 bp

Duplicates OL and OH
Duplicating part of minor and major arcs



Breakpoint flanking sequences
more information in Documentation - Flanking regions
6021 Non-duplicated region 14848
AAGCCTCCTTATTCGAGCCG 5'Breakpoint AGCTGGGCCAGCCAGGCAAC (...) TCCGCATGATGAAACTTCGG 3'Breakpoint CTCACTCCTTGGCGCCTGCC




Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [28] Fromenty, B., et al., Efficient and specific amplification of identified partial duplications of human mitochondrial DNA by long PCR. Biochimica et Biophysica Acta. 1993. 1308: p. 222-230.