Loading, please wait...

Loading, please wait.



5790 - 13924
Homo sapiens - Deletions

Deletion length: 8133 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
5790 Deleted region 13924
AGGTTTGAAGCTGCTTCTTC 5'Breakpoint GAATTTGCAATTCAATATGA (...) CCAACATACTCGGATTCTAC 3'Breakpoint CCTAGCATCACACACCGCAC




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
Patients with pathogenic POLG mutations
Inclusion body myositis

References

 [327] Nicholls, Thomas J., et al., Linear mtDNA fragments and unusual mtDNA rearrangements associated with pathological deficiency of MGME1 exonuclease. Human Molecular Genetics. 2014. 23: p. 6147-6162.

 [357] Rygiel, K.A., et al., Complex mitochondrial DNA rearrangements in individual cells from patients with sporadic inclusion body myositis..Nucleic acids research. 2016. 44(11): p.5313-5329.