Loading, please wait...

Loading, please wait.



5789 - 15450
Homo sapiens - Duplications

Duplication length: 6909 bp
Duplicated region: 15450:5789

Partially duplicated molecule length: 23478 bp

Duplicates OL and OH
Duplicating part of minor and major arcs



Breakpoint flanking sequences
more information in Documentation - Flanking regions
5789 Non-duplicated region 15450
CAGGTTTGAAGCTGCTTCTT 5'Breakpoint CGAATTTGCAATTCAATATG (...) CGCCCTCGGCTTACTTCTCT 3'Breakpoint TCCTTCTCTCCTTAATGACA




Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [20] Tengan, C. H., et al., Mitochondrial encephalomyopathy and hypoparathyrodism associated with a duplication and a deletion of mitochondrial deoxyribonucleic acid. Journal of Clinical Endocrinology and Metabolism. 1998. 83(1): p. 125-129.