5596 - 14999 Mus Musculus - Deletions Deletion length: 9402 bp	Breakpoint flanking sequences more information in Documentation - Flanking regions
	5596 5fl vs 3del Homology length: 3 bp Deleted region 14999 CCACTAATAATCGGAGCCCC ├ 5'Breakpoint ┤ AGATATAGCATTCCCACGAA (...) GCCATTCTACGCTCAATCCC ├ 3'Breakpoint ┤ CAATAAACTAGGAGGTGTCC 5fl vs 3fl Homology length: 1 bp CCACTAATAATCGGAGCCCC ├ 5'Breakpoint ┤ AGATATAGCATTCCCACGAA (...) GCCATTCTACGCTCAATCCC ├ 3'Breakpoint ┤ CAATAAACTAGGAGGTGTCC

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [13] Bacman, S. R., et al., Intra- and inter-molecular recombination of mitochondrial DNA after in vivo induction of multiple double-strand breaks.Nucleic Acids Research. 2009. 37(13): p. 4218-26.