463 - 314 Homo sapiens - Duplications Duplication length: 150 bp Duplicated region: 314:463 Partially duplicated molecule length: 16719 bp Duplicates OH Duplicating part of minor and major arcs	Breakpoint flanking sequences more information in Documentation - Flanking regions
	463 5fl vs 3del Homology length: 8 bp Non-duplicated region 314 ACACATTATTTTCCCCTCCC ├ 5'Breakpoint ┤ ACTCCCATACTACTAATCTC (...) TCCACCAAACCCCCCCTCCC ├ 3'Breakpoint ┤ CCGCTTCTGGCCACAGCACT 5fl vs 3fl Homology length: 2 bp ACACATTATTTTCCCCTCCC ├ 5'Breakpoint ┤ ACTCCCATACTACTAATCTC (...) TCCACCAAACCCCCCCTCCC ├ 3'Breakpoint ┤ CCGCTTCTGGCCACAGCACT

Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [31] Wei, Y-H., et al., Tandem duplications and large-scale deletions of mitochondrial DNA are early molecular events of human ageing process.Annals of New York Academy of Sciences. 1996. 786: p. 82-101.