Loading, please wait...

Loading, please wait.



4398 - 14822
Homo sapiens - Deletions

Deletion length: 10423 bp

Removes OL
Removing part of minor and major arcs



Breakpoint flanking sequences
more information in Documentation - Flanking regions
4398 Deleted region 14822
CCACCTATCACACCCCATCC 5'Breakpoint TAAAGTAAGGTCAGCTAAAT (...) TCGACCTCCCCACCCCATCC 3'Breakpoint AACATCTCCGCATGATGAAA




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [132] Ballinger, S.W., et al., Mitochondrial diabetes revisited. Nature Genetics. 1994. 7(4): p. 458-9.

 [133] Ballinger, S.W., et al., Maternally transmitted diabetes and deafness associated with a 10.4 kb mitochondrial DNA deletion. Nature Genetics. 1992. 1(1): p. 11-5.

 [134] Gerbitz, K.D., et al., Mitochondrial diabetes mellitus: a review. Biochimica Et Biophysica Acta. 1995. 1271(1): p. 253-60.