Loading, please wait...

Loading, please wait.



3567 - 15548
Homo sapiens - Duplications

Duplication length: 4589 bp
Duplicated region: 15548:3567

Partially duplicated molecule length: 21158 bp

Duplicates OH
Duplicating part of minor and major arcs



Breakpoint flanking sequences
more information in Documentation - Flanking regions
3567 Non-duplicated region 15548
TCGCTCTTCTACTATGAACC 5'Breakpoint CCCCTCCCCATACCCAACCC (...) CCTTAAACACCCCTCCCCAC 3'Breakpoint ATCAAGCCCGAATGATATTT




Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [22] Tang, Y., et al., Maintenance of human rearranged mitochondrial DNAs in long-term cultured transmitochondrial cell lines. Molecular Biology of the Cell. 2000. 11: p.2349-2358.