3266 - 9703 Homo sapiens - Deletions Deletion length: 6436 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	3266 5fl vs 3del Homology length: 3 bp Deleted region 9703 CGGTAATCGCATAAAACTTA ├ 5'Breakpoint ┤ AAACTTTACAGTCAGAGGTT (...) AATTCAAGCACTGCTTATTA ├ 3'Breakpoint ┤ CAATTTTACTGGGTCTCTAT 5del vs 3del Homology length: 1 bp CGGTAATCGCATAAAACTTA ├ 5'Breakpoint ┤ AAACTTTACAGTCAGAGGTT (...) AATTCAAGCACTGCTTATTA ├ 3'Breakpoint ┤ CAATTTTACTGGGTCTCTAT

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [303] Van Haute, L., et al., Human embryonic stem cells commonly display large mitochondrial DNA deletions. Nature Biotechnology. 2013. 31(1): p. 20-23.