Loading, please wait...

Loading, please wait.



3263 - 16071
Homo sapiens - Deletions

Deletion length: 12807 bp

Removes OL
Removing part of minor and major arcs



Breakpoint flanking sequences
more information in Documentation - Flanking regions
3263 Deleted region 16071
GCCCGGTAATCGCATAAAAC 5'Breakpoint TTAAAACTTTACAGTCAGAG (...) ACCACCCAAGTATTGACTCA 3'Breakpoint CCCATCAACAACCGCTATGT




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
Aged tissues
Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [6] Bodyak, N.D., et al., Quantification and sequencing of somatic deleted mtDNA in single cells: evidence for partially duplicated mtDNA in aged human tissues. Human Molecular Genetics. 2001. 10(1): p. 17-24.

 [9] Bua, E., et al., Mitochondrial DNA-deletion mutations accumulate intracellularly to detrimental levels in aged human skeletal muscle fibers. American Journal of Human Genetics. 2006. 79(3): p. 469-80.

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.