2059 - 16071 Homo sapiens - Duplications Duplication length: 2558 bp Duplicated region: 16071:2059 Partially duplicated molecule length: 19127 bp Duplicates OH Duplicating part of minor and major arcs	Breakpoint flanking sequences more information in Documentation - Flanking regions
	2059 5fl vs 3fl Homology length: 3 bp Non-duplicated region 16071 GTTCAACTTTAAATTTGCCC ├ 5'Breakpoint ┤ ACAGAACCCTCTAAATCCCC (...) ACCACCCAAGTATTGACTCA ├ 3'Breakpoint ┤ CCCATCAACAACCGCTATGT 5del vs 3del Homology length: 1 bp GTTCAACTTTAAATTTGCCC ├ 5'Breakpoint ┤ ACAGAACCCTCTAAATCCCC (...) ACCACCCAAGTATTGACTCA ├ 3'Breakpoint ┤ CCCATCAACAACCGCTATGT

Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [1] Bodyak, N. D., et al., Quantification and sequencing of somatic deleted mtDNA in single cells: evidence for partially duplicated mtDNA in aged human tissues. Human Molecular Genetics. 2001. 10(1): p. 17-24.