Loading, please wait...

Loading, please wait.



12104 - 14413
Homo sapiens - Deletions

Deletion length: 2308 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
12104 Deleted region 14413
CCCCATTCTCCTCCTATCCC 5'Breakpoint TCAACCCCGACATCATTACC (...) ACTAAAACACTCACCAAGAC 3'Breakpoint CTCAACCCCTGACCCCCATG




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
KSS; PS; PEO
Reye-like; MELAS; LS; Mitochondrial encephalomyopathy; Mitochondrial myopathy

References

 [45] Yamashita, S., et al., Genotype and phenotype analyses in 136 patients with single large-scale mitochondrial DNA deletions. Journal of Human Genetics. 2008. 53(7): p. 598-606.

 [46] Hammans, S.R., et al., Evidence for intramitochondrial complementation between deleted and normal mitochondrial DNA in some patients with mitochondrial myopathy. Journal of the Neurological Sciences. 1992. 107(1): p. 87-92.

 [47] Hammans, S.R., et al., A molecular genetic study of focal histochemical defects in mitochondrial encephalomyopathies. Brain. 1992. 115 ( Pt 2): p. 343-65.

 [48] Herzberg, N.H., et al., Kearns-Sayre syndrome with a phenocopy of choroideremia instead of pigmentary retinopathy. Neurology. 1993. 43(1): p. 218-21.

 [107] Rotig, A., et al., Spectrum of mitochondrial DNA rearrangements in the Pearson marrow-pancreas syndrome. Human Molecular Genetics. 1995. 4(8): p. 1327-30.