11232 - 13980 Homo sapiens - Deletions Deletion length: 2747 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	11232 5fl vs 3del Homology length: 3 bp Deleted region 13980 TACACCCTAGTAGGCTCCCT ├ 5'Breakpoint ┤ TCCCCTACTCATCGCACTAA (...) CTTCTTACGAGCCAAAACCT ├ 3'Breakpoint ┤ GCCCCTACTCCTCCTAGACC 5del vs 3del Homology length: 1 bp TACACCCTAGTAGGCTCCCT ├ 5'Breakpoint ┤ TCCCCTACTCATCGCACTAA (...) CTTCTTACGAGCCAAAACCT ├ 3'Breakpoint ┤ GCCCCTACTCCTCCTAGACC

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
PS
Diabetes mellitus and deafness

References

 [116] Rotig, A., et al., Site-specific deletions of the mitochondrial genome in the Pearson marrow-pancreas syndrome. Genomics. 1991. 10(2): p. 502-4.

 [123] Awata, T., et al., Japanese case of diabetes mellitus and deafness with mutation in mitochondrial tRNA(Leu(UUR)) gene. Lancet. 1993. 341(8855): p. 1291-2.

 [124] Cormier, V., et al., Widespread multi-tissue deletions of the mitochondrial genome in the Pearson marrow-pancreas syndrome. Journal of Pediatrics. 1990. 117(4): p. 599-602.

 [125] Rotig, A., et al., Pearson's marrow-pancreas syndrome. A multisystem mitochondrial disorder in infancy. Journal of Clinical Investigation. 1990. 86(5): p. 1601-8.

 [265] Rocher, C., et al., Base composition at mtDNA boundaries suggests a DNA triple helix model for human mitochondrial DNA large-scale rearrangements. Molecular Genetics and Metabolism. 2002. 76(2): p. 123-32.