10961 - 15846 Homo sapiens - Deletions Deletion length: 4884 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	10961 5fl vs 3del Homology length: 9 bp Deleted region 15846 AACAACCCCCCTCCTAATAC ├ 5'Breakpoint ┤ TAACTACCTGACTCCTACCC (...) AACAATCCTAATCCTAATAC ├ 3'Breakpoint ┤ CAACTATCTCCCTAATTGAA 5fl vs 3fl Homology length: 1 bp AACAACCCCCCTCCTAATAC ├ 5'Breakpoint ┤ TAACTACCTGACTCCTACCC (...) AACAATCCTAATCCTAATAC ├ 3'Breakpoint ┤ CAACTATCTCCCTAATTGAA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [108] Oldfors, A., et al., Mitochondrial DNA deletions and cytochrome c oxidase deficiency in muscle fibres. Journal of the Neurological Sciences. 1992. 110(1-2): p. 169-77.

 [265] Rocher, C., et al., Base composition at mtDNA boundaries suggests a DNA triple helix model for human mitochondrial DNA large-scale rearrangements. Molecular Genetics and Metabolism. 2002. 76(2): p. 123-32.

 [329] Vielhaber, Stefan, et al., Mitofusin 2 mutations affect mitochondrial function by mitochondrial DNA depletion. Acta Neuropathologica. 2013. 125(2): p. 245-256.