10749 - 14129 Homo sapiens - Deletions Deletion length: 3379 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	10749 5fl vs 3del Homology length: 5 bp Deleted region 14129 AGACTACGTACATAACCTAA ├ 5'Breakpoint ┤ ACCTACTCCAATGCTAAAAC (...) CTTCTTCCCACTCATCCTAA ├ 3'Breakpoint ┤ CCCTACTCCTAATCACATAA 5del vs 3del Homology length: 1 bp AGACTACGTACATAACCTAA ├ 5'Breakpoint ┤ ACCTACTCCAATGCTAAAAC (...) CTTCTTCCCACTCATCCTAA ├ 3'Breakpoint ┤ CCCTACTCCTAATCACATAA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
Aged tissues
Chronic diarrhea and villous atrophy

References

 [6] Bodyak, N.D., et al., Quantification and sequencing of somatic deleted mtDNA in single cells: evidence for partially duplicated mtDNA in aged human tissues. Human Molecular Genetics. 2001. 10(1): p. 17-24.

 [135] Cormier-Daire, V., et al., Mitochondrial DNA rearrangements with onset as chronic diarrhea with villous atrophy. Journal of Pediatrics. 1994. 124(1): p. 63-70.

 [265] Rocher, C., et al., Base composition at mtDNA boundaries suggests a DNA triple helix model for human mitochondrial DNA large-scale rearrangements. Molecular Genetics and Metabolism. 2002. 76(2): p. 123-32.