Loading, please wait...

Loading, please wait.



10746 - 14125
Homo sapiens - Deletions

Deletion length: 3378 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
10746 Deleted region 14125
CCTAGACTACGTACATAACC 5'Breakpoint TAAACCTACTCCAATGCTAA (...) CTTTCTTCTTCCCACTCATC 3'Breakpoint CTAACCCTACTCCTAATCAC




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
Mitochondrial myopathy
Peripheral myopathy

References

 [7] Yuzaki, M., et al., Multiple deletions in mitochondrial DNA at direct repeats of non-D-loop regions in cases of familial mitochondrial myopathy. Biochemical and Biophysical Research Communications. 1989. 164(3): p. 1352-7.