10668 - 14859 Homo sapiens - Deletions Deletion length: 4190 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	10668 5fl vs 3del Homology length: 3 bp Deleted region 14859 TATTGCCATACTAGTCTTTG ├ 5'Breakpoint ┤ CCGCCTGCGAAGCAGCGGTG (...) AAACTTCGGCTCACTCCTTG ├ 3'Breakpoint ┤ GCGCCTGCCTGATCCTCCAA 5fl vs 3fl Homology length: 1 bp TATTGCCATACTAGTCTTTG ├ 5'Breakpoint ┤ CCGCCTGCGAAGCAGCGGTG (...) AAACTTCGGCTCACTCCTTG ├ 3'Breakpoint ┤ GCGCCTGCCTGATCCTCCAA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
PS
Chronic diarrhea and villous atrophy

References

 [107] Rotig, A., et al., Spectrum of mitochondrial DNA rearrangements in the Pearson marrow-pancreas syndrome. Human Molecular Genetics. 1995. 4(8): p. 1327-30.

 [116] Rotig, A., et al., Site-specific deletions of the mitochondrial genome in the Pearson marrow-pancreas syndrome. Genomics. 1991. 10(2): p. 502-4.

 [135] Cormier-Daire, V., et al., Mitochondrial DNA rearrangements with onset as chronic diarrhea with villous atrophy. Journal of Pediatrics. 1994. 124(1): p. 63-70.